DNA REPLICATION
We have seen earlier that the continuance of the information flow to progeny and somatic cells is maintained by the DNA. This task is accomplished by the meticulous plan of DNA replication. Since DNA makes its own copies using the pre-existing DNA, the synthesis of DNA is referred as replication. Since only one strand of the double stranded DNA is newly synthesized, therefore, its replication is called as semi-conservative. However, in terms of contents, the resulting two helices are exactly identical with the original helix. The two strands of DNA double helix are united by hydrogen bonds between purine and pyrimidine base pairs.
The initiation of the replication is marked by a cut or nick made by endonuclease on one of the strands of DNA. For replication, DNA binding proteins and DNA gyrase open up the DNA helix. Gyrase binds on a single strand and initiates uncoiling of coiled strands. The unwinding of strands results in the development of strain in the remaining helix and is relieved by the action of a superhelix relaxing protein. Next, an RNA polymerase catalyzes formation of a small stretch of RNA (primer) on one of the DNA templates. DNA polymerase III catalyzes the addition of nucleotides to the 3'ends of the newly synthesized RNA primer and thus begins the synthesis of DNA. Later, this RNA primer is degraded by DNA polymerase I which also synthesizes a small DNA segment to replace RNA primer. The newly formed DNA segment is ligated by an enzyme, DNA ligase. The DNA helix is antiparallel i.e., one strand runs 5'-3' while the run has direction 3'-5'. All DNA polymerases make daughter strands only in the 5'-3' direction. At least one strand of the DNA is synthesized discontinuously i.e., in the form of Okazaki fragments which are later ligated by the enzyme DNA ligase. This is because of the fact that the direction of DNA synthesis is always 5'→3' (5 prime to 3 prime) while the two parent strands are always antiparallel. This discontinuous strand is called as lagging strand.
Models of DNA replication
The two strands of the DNA are attached together by the hydrogen bonds; thus, they are capable of separating from each other only after their breakdown. The semiconservative model is based on the fact that one half of the parental strand is conserved and the other strand complementary to the existing parental strand is synthesised. Furthermore, in the conservative model of replication, the complete original parental double helix acts as a template for the synthesis of another double helix, where one daughter cell contains the complete parental DNA whereas the other daughter would synthesise the completely new DNA. In the dispersive model, some portion of the original parental DNA is conserved along some new portions are synthesised. In this replication model, the parental DNA strand breaks into small DNA segments that act as a template and then the synthesis of the complete DNA takes place according to the conservative model of replication.
Replication of DNA in prokaryotes
Replication of DNA in prokaryotes can be explained using E. coli as the model organism. It contains a single long circular DNA as its genetic material and the replication starts at a unique site called as origin (Oric). The Oric region is unique as it contains three repeats of a 13 base pairs (bp) sequence (GATCTNTTNTTTT) and four repeats of 9 bp sequence (TTATNCANA). The origin of replication has also been characterised in many plasmids and phages and these are generally rich in A:T base pairs. This makes melting or uncoiling of this region easy since A:T base pairs contain two H-bonds as compared to triple H-bonds in case of G: C.
The replication of this circular polynucleotide is bidirectional, i.e., replication bubble has two replication forks. DNA synthesis then proceeds in both directions from the single origin. Thus, the region of parent DNA under replication is called as a replication bubble or replication eye and consists of two replication forks moving in opposite directions on the circular bacterial DNA. In rolling circular mechanism, the fork starts to ensue around a circular template of DNA. The replication starts by introducing a nick in one of the two phosphodiester bonds. The nicking in a circular strand laid to the opening of one strand, resulting into the generation of free 3' OH end, which could serve as a template for the polymerase. As the polymerase extends the strand from the 3' end, the end from the 5' direction displaced, and this displaced strand now act as a template for the synthesis of another strand (lagging). The consequence of such a replication results in the formation of concatemer copies of the circular molecule. Similar to the rolling circle mechanism in the theta replication at the end of the replication machinery the two forks ultimately meet, fuse and two circular daughter DNA molecules generates, each having one parental and one newly formed DNA strand.
Biochemistry of DNA replication
DNA polymerases
DNA polymerases carry out condensation of dNTPs to form a polynucleotide chain. DNA polymerase is also called as Kornberg’s enzyme after A. Kornberg who first isolated it from E. coli. The enzyme is a single polypeptide (109 kD) which upon digestion with trypsin is broken into two subunits: (i) Klenow fragment (75 kD) having polymerase and 3'-5' exonuclease activity and (ii) a small fragment (38 kD) which has only 5'-3' exonuclease activity.
Three different types of DNA polymerases, i.e., DNA polymerase I, II and III are found.
Now it is known that the DNA polymerase I (Kornberg’s enzyme) of E. coli is not the primary enzyme in DNA replication but has only very specialised function of DNA repair. The chief enzyme in DNA replication is DNA polymerase III which is a hetero-multimeric enzyme with molecular weight more than 250 kD. The 160 kD catalytic core of this DNA polymerase III is made up on a-subunit (Mr 130 kD) having polymerase activity, one ɛ-subunit (25 kD) and one θ-subunit (10 kD). ɛ and θ-subunit are responsible for assembly and proof-reading activities. Two such core enzymes condense to form a dimer Pol III*, with the help of two t-subunits (71 kD each). One of the a-subunits gets associated with two y-subunits (52 kD each) and two δ-subunits (32 kD each) resulting in the multimeric polymerase III having molecular weight 750 kD. Further, this multimeric protein is joined by β-subunits to complete the holoenzyme (900 kD) which is the complete and fully functional DNA polymerase III. The structure and assembly of Pol III is explained in the Fig 5.
The DNA polymerase enzyme requires all the four dNTPs, a DNA template and a primer with a free 3'-OH in presence of Mg2+ ions. These enzymes are directed by the original parent DNA template, in which polymerase recognizes the next nucleotide to be added. Polymerase then adds a complementary nucleotide to the 3'-OH of the primer by creating a 3'-5' phosphodiester bond from which the inorganic phosphate is released. The 3'-OH group makes a nucleophilic attack on the α-phosphate of the incoming nucleotide.
The replication is initiated by binding of a factor DnaA (82 kD protein) that recognizes origin and binds to it. This is followed by binding of a pre-priming factor, DnaT (66 kD) and helicase which causes uncoiling of a small stretch of DNA. The uncoiled region of DNA is joined by SSB (single stand binding) proteins, a tetramer of 74 kD DnaB which prevents renaturation of uncoiled DNA. Some ancillary proteins cause the activation of primase which synthesizes RNA primer at the site of origin. The binding of DnaB is also facilitated by another hexameric protein, DnaC. DNA polymerase III adds single nucleotides to the free 3'-OH end of RNA primer and continues. The complete complex of DNA polymerase, primase and ancillary proteins is referred to as primosome.
DNA polymerase I correct or proof reads the wrongly incorporated or mismatched nucleotides by its proof-reading activity. A wrong base is removed using 3'-5' exonuclease activity and hence the error rate in DNA synthesis is very less (below 10 raise to the power -8 per base pair). DNA polymerase I also has 5'-3' exonuclease activity and can also remove nucleotide from the 5' end of a polynucleotide. This 5'-3' exonuclease activity is also used to remove RNA primer earlier used for initiating DNA synthesis. DNA polymerase II and III also have all the activities similar to DNA polymerase I but lack for 5'-3' exonuclease activity.
RNA Primer
Presence of RNA primer is essential for DNA replication as DNA polymerase can add nucleotide only to a template at 3'-OH end. The RNA primer is a short segment (5 nucleotide long) synthesized by primase (RNA polymerase). RNA polymerase can make RNA directly on the single strand DNA template since it does not require any primer to be synthesized. This RNA primer is extended by DNA polymerase in a bidirectional fashion. After DNA is synthesized by DNA polymerase III, DNA polymerase I removes RNA primer by its 5'-3' exonuclease activity and replaces it with DNA. The newly synthesised fragment is ligated by DNA ligase. DNA polymerase III cannot remove RNA primer as it lacks 5'-3' exonuclease activity.
Several enzymes and accessory proteins, participate in bacterial chromosome replication. DNA helicase is used for unwinding the double helix. It uses ATP energy in unwinding along with SSBP (single strand binding protein) that prevents the renaturation between base pairs of the unwound DNA. If you visualize a replication fork moving along a DNA helix then the unwinding of DNA would make the DNA rotate rapidly (just like unwinding two strand of a rope). The bacterial chromosome is circular and thus has no ends to rotate. In this situation the rotation of DNA will result in coiling of the circular chromosome and will halt the process. However, an enzyme, topoisomerase or gyrase, breaks a phosphodiester bond in one strand allowing the DNA to rotate freely around the other intact strand. Once new DNA fragment is synthesized, the phosphodiester bond is reformed by the same topoisomerase. The resulting two daughter DNA molecules are intertwined. These are separated by another enzyme topoisomerase II. This enzyme causes a double strand break in one of the DNA molecule. Topoisomers are the different physical forms of the same DNA molecule. Topoisomerase help interconvert DNA into its different topoisomers. These enzymes help DNA get unwound at a rapid speed. It creates a small nick in one strand, allowing the molecule to uncoil and thus reduces the strain in the helix. As described earlier Type I topoisomerase cleave only one strand of the DNA molecule and help in relaxation of negative supercoiling of the DNA while topoiosmerase II cleave both the strands of DNA molecule and consume ATPs during cleavage. DNA ligase joins two nucleotide or polynucleotide ends (3' OH and 5' PO4 groups). Primase isan RNA polymerase that synthesizes primer RNA molecule that serves as a template for DNA polymerase to start condensation of nucleotides. Helicase helps in formation of single strands in the region undergoing replication by unwinding the two intertwined strands with the expense of energy (ATP). Other factors such as SSBP (single strand binding proteins) and auxiliary proteins are also associated with DNA replication.
DNA replication in eukaryotes
A eukaryotic cell divides by cell cycle into two identical daughter cells carrying same genetic material. A typical cell cycle consists of G1 (gap) phase, S (synthesis) phase where DNA is replicated and G2 phase in which the cell prepares for mitosis. The eukaryotic replication starts at multiple origins located at every 300 kb of DNA and proceeds bidirectionally at all the points. This speeds up the chromosomal replication. At each origin there is a replicon consisting of two replication forks moving in opposite directions. The replication continues till all such replication bubbles merge.
Eukaryotic cells contain five different polymerases, where in α and δ are involved in DNA replication while ẞ and ɛ are involved in DNA repair. All these are located within the nucleus excepting γ DNA polymerase found in cytoplasm which carries out replication of extrachromosomal (mitochondrial) DNA replication.
The mechanism of DNA replication in eukaryotes is similar to that of prokaryotes involving formation of lagging and leading strand. Lagging strand involves formation of small fragments of DNA or Okazaki fragments. The speed of DNA replication is much slower in eukaryotes than in prokaryotes and also the two strands are synthesised by two different polymerases. The DNA polymerase α catalyzes synthesis of Okazaki fragments (lagging strands) whereas DNA polymerase 8 synthesizes continuous or the leading strand.
The speed of DNA replication depends upon the average replicon size and the multiplicity of replicons during replication. For example, in yeast Saccharomyces cerevisiae (genome size- 20,000 kb), the average replicon size is 40 kb and there is formation of 500 replicons during replication with a rate of DNA synthesis averaging 50-60 bp / seconds. Looking at the size of human genome, 6 x 106 Kb and the average rate of replication to be 2.2 kb/minute, it will take 45,000 hrs for the complete replication of human genome. However, it actually takes only 9 hrs because of multiple origins or replicons during eukaryotic DNA replication.
Termination of DNA replication
The termination of replication is brought about by the specific sequences. E. coli has a circular genome and the replication forks originating from a single origin may meet half the way down. Two characteristic sequences terD and terA carry out termination of E. coli DNA replication of forks. Each of these ter regions has a consensus sequence of 23 base pairs (AATTAGTATGTTGTAACTAAAGT). This sequence is shown to cause termination of DNA synthesis in vitro as well. Termination is mediated by a protein coded by tus gene which recognizes ter region and binds to it and interferes with the functioning of DNA polymerase to halt the DNA replication.
Mechanism of replication: Telomere replication
The replication of telomeric repeats is independent of normal DNA replication machinery. The normal DNA replication machinery fails to replicate the extreme 5' end of the chromosome, thus a unique enzyme named telomerase catalyses the endpoint replication of the chromosome. It contains RNA and protein i.e., ribonucleoprotein.
It is an RNA-dependent DNA polymerase, as the name suggests, it synthesizes and elongates the DNA by using RNA as a template which is the component of the enzyme itself. It recognizes the G-rich region present at the tip of the strand and elongates the strand in a 5' to 3' direction, uses the 3' OH present at the terminal of the GT hairpin as a primer, and extends the existing strand. After subjecting the DNA strand for several rounds of extension by telomerase, the replication of the lagging strand at the end of the chromosome is said to be completed.
TEST QUESTIONS
A. Multiple Choice Type Questions
1. The enzyme that unwinds DNA before replication is
A. Telomerase
B. Helicase
C. Polymerase
D. Endonuclease
2. The DNA replication is
A. Conservative
B. Semi-conservative
C. Antiparallel
D. all the above
3. The Okazaki fragments are formed in
A. Leading strand
B. Lagging strand
C. both
D. None of these
Comments